Packages

A bioinformatics project for Elixir.

Current section

Files

Jump to
bio_ex lib restriction restriction.ex
Raw

lib/restriction/restriction.ex

defmodule Bio.Restriction do
@moduledoc """
`Bio.Restriction` houses the functions related to restriction enzyme data and
activity. The primary function is `digest`. The `digest` function works by
recursively breaking down a binary and checking to see if the pattern for a
given enzyme exists within it.
Restriction is also the namespace for `Enzyme`, where functions for accessing
all the downloaded restriction enzyme data lives. Inside of
`Bio.Restriction.Enzyme` there is a struct defined. Each method named in the
lowercase fashion of the restriction enzymes returns an instance of this
struct.
The enzyme HpyUM037X is removed from the set, since it has two conflicting
entries in the emboss data. If you can resolve this distinction, please feel
free to either contribute a fix, or open an issue that explains how one would
be implemented.
TODO: Currently we don't support enzymes that have two cut sites
TODO: Currently we don't support enzymes with ambiguous DNA recognition
"""
@doc """
Digest takes in a string, anticipated to be a DNA sequence, and extracts the
components of the string as a tuple that would remain after digestion with a
given restriction enzyme.
## Examples
iex> Bio.Restriction.digest("ttagatgacgtctcgattagagt", Bio.Restriction.Enzyme.bsmbi)
["ttagatgacgtctcg", "attagagt"]
Currently this will work for enzymes that look back as well:
iex> Bio.Restriction.digest("ggatgcagatcagacgaggattga", Bio.Restriction.Enzyme.bsp143i)
["ggatgc", "agatcagacgaggattga"]
It does not yet work on enzymes that would produce digestions with three parts
such as NmeDI, nor will it work on enzymes whose recognition pattern is
defined using ambiguous DNA (even simply N).
"""
def digest(dna, enzyme) do
_digest("", dna, enzyme)
|> List.flatten()
end
defp _digest(
left,
right,
%Bio.Restriction.Enzyme{
pattern: pattern,
cut_1: cut_site_offset,
cut_2: _fst3,
cut_3: second_cut,
cut_4: _scd3
} = enzyme
)
when second_cut == 0 do
dna_segment_size = byte_size(right)
restriction_pattern_size = byte_size(pattern)
cond do
# This is the base case, we can't reduce the sequence further
dna_segment_size <= restriction_pattern_size or dna_segment_size <= cut_site_offset ->
[left <> right]
dna_segment_size > restriction_pattern_size ->
cut_site = 1 + cut_site_offset
<<left_product::binary-size(cut_site), right_product::binary>> = right
<<uncut::binary-size(1), check::binary-size(restriction_pattern_size), remaining::binary>> =
right
cond do
pattern == check and left <> left_product != "" ->
[
left <> left_product,
_digest("", right_product, enzyme)
]
true ->
_digest(left <> uncut, check <> remaining, enzyme)
end
end
end
end